---
title: Omicron impact on SARS-CoV-2 mutation analysis and investigation
description: The new variant of concern, Omicron, has nearly 50 mutations. Here are our preliminary findings on how they impact diagnostic assays and our mitigation plans in place should a mutation fall within the target sequence.
image: https://blog.biosearchtech.com/hubfs/omicron.jpg
---

[![LGC BTI logo](https://www.biosearchtech.com/Content/images/sourceimages/logo-bt.svg "LGC BTI logo")](https://www.biosearchtech.com/)

![Biosearch_Technologies_Logo_RGB_White_no tagline](https://blog.biosearchtech.com/hs-fs/hubfs/Biosearch_Technologies_Logo_RGB_White_no%20tagline.png?width=180&height=39&name=Biosearch_Technologies_Logo_RGB_White_no%20tagline.png)

 

[Blog](https://blog.biosearchtech.com) / Technical bulletin: Omicron impact on SARS-CoV-2 mutation analysis and investigation

# Technical bulletin: Omicron impact on SARS-CoV-2 mutation analysis and investigation

[Molecular diagnostics](https://blog.biosearchtech.com/topic/molecular-diagnostics) | [SARS-CoV-2](https://blog.biosearchtech.com/topic/sars-cov-2)

**Time to read:**   6 minute read

Originally published : Wed, December 22, 2021 @ 10:22 PM

*Updated : Wed, March 22, 2023 @ 2:01 PM*

The emergence of the Omicron lineage has quickly escalated to be a variant of concern by the World Health Organization - joining the ranks of the Delta variant in worrisome indicators of increased chance of reinfection. Of its collection of nearly 50 mutations, most of the reported Omicron mutations (33/48) affect the Spike-gene, but there are also reported mutations along the SARS-CoV-2 gRNA. As previously reported ([**Technical Bulletin 1**](https://biosearch-cdn.azureedge.net/assetsv6/technical-bulletin_sars-cov-2-variants-mutations.pdf)), LGC, Biosearch Technologies™ has a four-tier assay screening and replacement programme to identify and mitigate against the risk of assay impairment in the event of a mutation arising within the target binding site of our COVID-19 diagnostic assay.

1. Assays are monitored at fortnightly intervals. This includes the N1 and N2 assays which are components of our [**ultra-high-throughput SARS-CoV-2 testing systems**,](https://www.biosearchtech.com/covid-19/lgcs-scalable-solution-to-support-mass-testing-for-covid-19?utm_source=blog.biosearch.com&utm_medium=blog&utm_campaign=gglobal21feb_mdxvariant&utm_content=hyperlink) [**2019-nCoV ValuPanel™ Reagents**](https://www.biosearchtech.com/products/pcr-kits-and-reagents/qpcr-assays/valupanel-reagents/2019-ncov-valupanel-reagents?utm_source=blog.biosearch.com&utm_medium=blog&utm_campaign=gglobal21feb_mdxvariant&utm_content=hyperlink), and the SC2 assay (N gene) which is a component of the[** Influenza SARS-CoV-2 Multiplex ValuPanel Reagents**](https://www.biosearchtech.com/products/pcr-kits-and-reagents/qpcr-assays/valupanel-reagents/influenza-sars-cov-2-multiplex-valupanel-reagents?utm_source=blog.biosearch.com&utm_medium=blog&utm_campaign=gglobal21feb_mdxvariant&utm_content=hyperlink) (Table 1).
2. Each of these sequences is compared to published sequences that are reported in the GISAID database.
3. Any mutations of concern are subjected to further *in silico* analysis and wet lab verification if required.
4. Additional assays have been evaluated as ready for deployment, should a detrimental mutation be identified. These additional assays are also under constant surveillance.

**Table 1 Sequences of oligonucleotides used in SARS-CoV-2 detection assays (written in 5′ to 3′ direction)**

| **Assay** | **Oligo ID** | **Sequence** |
| --- | --- | --- |
| CDC N1 | 2019-nCoV_N1-F | GACCCCAAAATCAGCGAAAT |
| 2019-nCoV_N1-R (RT primer) | TCTGGTTACTGCCAGTTGAATCTG |  |
| 2019-nCoV_N1 Probe | FAM-ACCCCGCATTACGTTTGGTGGACC-BHQ-1 |  |
| CDC N2 | 2019-nCoV_N2-F | TTACAAACATTGGCCGCAAA |
| 2019-nCoV_N2-R (RT primer) | GCGCGACATTCCGAAGAA |  |
| 2019-nCoV_N2 Probe | FAM-ACAATTTGCCCCCAGCGCTTCAG-BHQ-1 |  |
| RNase P | RP-F | AGATTTGGACCTGCGAGCG |
| RP-R | GAGCGGCTGTCTCCACAAGT |  |
| RP-P (CFO560) | CalFluorOrange560-TTCTGACCTGAAGGCTCTGCGCG-BHQ-1 |  |
| SC2 | SC2-F | CTGCAGATTTGGATGATTTCTCC |
| SC2-R | CCTTGTGTGGTCTGCATGAGTTTAGG |  |
| SC2-P (CFR610) | CalFluorRed610ATTGCAACAATCCATGAGCAGTGCTGACTC-BHQ1 |  |

 

## ***Mutation analysis procedure***

1. **Fortnightly* in silico* screen evaluation of sequences submitted to GISAID**: N1, N2, SC2 and variant specific ValuPanel ([**see Technical Bulletin 2**](https://blog.biosearchtech.com/technical-bulletin-sars-cov-2-delta-variant-and-mutations?utm_source=blog.biosearch.com&utm_medium=blog&utm_campaign=gglobal21feb_mdxvariant&utm_content=hyperlink)) assay oligonucleotide (oligo) target sequences are screened against SARS-CoV-2 gRNA sequences submitted to the GISAID SARS-CoV-2 database. Mismatches between database viral sequence and assay oligonucleotide sequences are highlighted for further investigation. Due to the emergence of the Omicron variant, an additional *in silico* screen was performed against the Omicron sequences submitted to GISAID.
2. **News reports, customer enquiries, public health, government technical briefing documents**: Any mutations covered in news outlets, reported to Biosearch Technologies by customers or published in official communications such as technical briefings (UKHSA) are considered for evaluation. WHO or CDC communications are also highlighted for further investigation.
3. **Screening of N1/N2 replacement assays:** There is a programme in place to identify assays that could mitigate for sub-optimal performance when using the N1 or N2 (Table 1) assays, should a mutation occur in the target sites which cause assay failure. These potential replacement assays have undergone thorough sequence evaluation and are also included in the regular screen against sequences held in GISAID. If any mutation lies in the target site of the potential replacement assays, these are also highlighted for further investigation.

## ***Mutation analysis and investigation***

**Prevalence:**

1. All mutations occurring in at least 0.1% of GISAID global sequences and lying in the target sequences of the N1, N2, SC2 and replacement assays are investigated.
2. All mutations lying in the target sequences of the N1, N2, SC2 and mitigation assays occurring in at least 1.0% of sequences from an individual country are also examined.

**Mutation location:** Of the sequences with the defined prevalence in GISAID, mutations lying within the five bases at the 3′ of a primer or the central 50% of a probe are taken forward for wet lab testing. Single base mismatches lying outside of this region are reported to have low impact on assay performance.2

**T****m**** change estimate: **The Tm of the assay oligo with the matched target sequence is compared to that of the mismatched target using *in silico* assessment. In our past wet lab analysis, Tm changes <5C have resulted in Cq changes <2 in qPCR studies and did not affect sensitivity of ePCR assays.

## ***In silico screening results for all SARS-CoV-2 sequences submitted to GISAID***

The *N1*, *N2*, SC2 and replacement assay gene sequences were screened against SARS-CoV-2 sequences submitted to GISAID (up until 12 December 2021). As per the prevalence conditions stated above, no mutations reported by UKHSA, WHO or CDC were identified in the replacement assay or in SC2. There is one mutation in N1 and one mutation in N2 that occurs at oligo target sites and meets the prevalence requirements for further investigation.

G28326T (N:G18V) was identified in the N1 probe and wet lab studies have been initiated to look for impairments to the N1 assay. The *in silico* thermodynamic calculation of the Tm mismatch suggests that this mutation will not affect assay performance. It has been reported to be present in 95.2% of the Delta sublineage AY.475. This lineage exceeds global prevalence levels (1%) in Sierra Leone (12%), Guyana (8%), Saint-Barthelemy (7%), Anguilla (5%) and the United States (2%).

The identification of G29179T in the N2 F primer was discussed in the previous [technical bulletin](https://blog.biosearchtech.com/technical-bulletin-sars-cov-2-mutation-analysis-and-investigation). While it is still reaching investigative thresholds globally and regionally (Wales, UK), it has decreased in prevalence. Additionally, this mutation did not detrimentally affect N2 assay performance in our web lab analysis. This mutation does not lead to a change in the protein.

Mutations are relative to the SARS-CoV-2 reference sequence NC_045512.2 and the naming convention is described in [**“Emerging SARS-CoV-2 mutations and their effect on the immune response” technical bulletin**](https://blog.biosearchtech.com/technical-bulletin-sars-cov-2-delta-variant-and-mutations?utm_source=blog.biosearch.com&utm_medium=blog&utm_campaign=gglobal21feb_mdxvariant&utm_content=hyperlink).3

***Table 2 Analysis of mutations at oligo target sites that reach investigative thresholds for global and/or regional screens as of 12 December 2021 screen ***

| **Region** | **Mutation in probe central region or primer 3' (five bases)** | **Assay affected** | **Oligo** | **Frequency of mutation (GISAID Global/region)** | **Delta T****m**** (°C)** **PCR** | **Impact on assay performance** |
| --- | --- | --- | --- | --- | --- | --- |
| USA | G28326T | N1 | probe | 0.72/2.06 | -2.1 | TBD |
| UK(Wales) | G29179T | N2 | F primer | 0.43/1.99 | -6.6 | No |

 

## ***Additional in silico screening results for 447 Omicron sequences submitted to GISAID***

In addition to the scheduled routine screening, an evaluation was performed following the classification of the B.1.1.529 variant (Omicron) as a variant of concern on 26 November 2021.6 An initial screen was performed on 29 November 2021 with 144 sequences submitted to GISAID and repeated on 3 December 2021 with 447 sequences. Three mutations from these screens demonstrated changes at abundance >1.5% in the 447 Omicron sequences, including a single change in the N1 probe five prime (position 3 C28311T, T in 84% of Omicron sequences; Table 3). These changes are not expected to impact on the performance of the assay but, given the potential for Omicron to be a primary variant of concern, wet laboratory evaluation has been initiated for mutations >80% of omicron sequences.

***Table 3: Omicron mutation impact analysis***

| **Gene target** | **Oligo** | **Position** | **Mutation relative to **NC_045512.2 | **Percentage of Omicron sequences** | **Delta Tm (°C)** **PCR/RT** | **Wet testing?** | **Sensitivity of target affected?** |
| --- | --- | --- | --- | --- | --- | --- | --- |
| N1 | Probe | 3 from 5' end | C28311T | 84% | -4.4 | Initiated | TBD |
| N1 | Forward primer | 5 from 5' end | C28291T | 2.9 % | -7.9/NA | TBD | TBD |

*** ***

## ***Conclusion***

Biosearch Technologies has adopted an aggressive screening approach of our diagnostic assays to ensure the highest vigilance. Regular *in silico* analysis of mutations of concern ensures the rapid identification of any potential lack of function of our assays. Subsequent wet lab testing facilitates an understanding of how any mutation would impact the assay in the diagnostic setting. The Omicron variant is reported to have two mutations under the N1 assay and 1 mutation under the replacement assay. Wet laboratory testing has been initiated to test the effects of the C23811T on the N1 assay. C28291T is being monitored for changes. At the time of reporting it was limited to 13 of the 447 (2.9%) sequences in the GISAID database. While the reported mutations are not in key locations, we are further monitoring Omicron sequences for the presence of co-occurring mutations within the assay. If two or more Omicron mutations lie within the diagnostic assays, we will perform wet lab testing to evaluate the co-ordinated effect these multiple mutations have on the diagnostic assay. The replacement assay programme is in place to swiftly deploy a new assay should we discover that the sequences of the assay are compromised.

***References***

1. Overview of Variants in Countries.[**https://covariants.org/per-country**](https://covariants.org/per-country). Accessed December 2021.
2. Lefever S, Pattyn F, Hellemans J, Vandesompele J. Single-nucleotide polymorphisms and other mismatches reduce performance of quantitative PCR assays. *Clin Chem*. 2013 Oct;59(10):1470-80. [**https://doi.org/10.1373/clinchem.2013.203653**](https://doi.org/10.1373/clinchem.2013.203653). Published 2013.
3. Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome. NCBI Reference Sequence: NC_045512.2.[**https://www.ncbi.nlm.nih.gov/nuccore/NC_045512**](https://www.ncbi.nlm.nih.gov/nuccore/NC_045512).
4. Ziegler K, Steininger P, Ziegler R, Steinmann J[**,**](https://www.eurosurveillance.org/search?value1=J%C3%B6rg+Steinmann&option1=author&noRedirect=true)Korn K, Ensser A. SARS-CoV-2 samples may escape detection because of a single point mutation in the N gene. *Euro Surveill.* 2020;25(39):pii=2001650. [**https://doi.org/10.2807/1560-7917.ES.2020.25.39.2001650**](https://doi.org/10.2807/1560-7917.ES.2020.25.39.2001650). Published 30 September 2020.
5. Abdel Latif A, Mullen JL, Alkuzweny M, Tsueng G, Cano M, Haag E, Zhou J, Zeller M, Hufbauer E, Matteson N, Wu C, Andersen KG, Su AI, Gangavarapu K, Hughes LD and the Center for Viral Systems Biology. Lineage Comparison. Outbreak.info. [https://outbreak.info/compare-lineages?pango=B.1.1.7&pango=B.1.351&pango=P.1&pango=B.1.617.2&pango=B.1.617.1&pango=B.1.525&pango=P.2&pango=A.23.1&pango=B.1.1.318&pango=B.1.324&pango=P.3&gene=ORF1a&gene=ORF1b&gene=S&gene=N&gene=E&threshold=99](https://outbreak.info/compare-lineages?pango=B.1.1.7&pango=B.1.351&pango=P.1&pango=B.1.617.2&pango=B.1.617.1&pango=B.1.525&pango=P.2&pango=A.23.1&pango=B.1.1.318&pango=B.1.324&pango=P.3&gene=ORF1a&gene=ORF1b&gene=S&gene=N&gene=E&threshold=99). Accessed 19 December 2021
6. World Health Organization. Classification of Omicron (B.1.1.529): SARS-CoV-2 Variant of Concern. [**https://www.who.int/news/item/26-11-2021-classification-of-omicron-(b.1.1.529)-sars-cov-2-variant-of-concern**](https://www.who.int/news/item/26-11-2021-classification-of-omicron-(b.1.1.529)-sars-cov-2-variant-of-concern). Published 26 November 2021. Accessed 06 December 2021.

- [**](http://www.facebook.com/sharer.php?u=https://blog.biosearchtech.com/technical-bulletin-omicron-impact-on-sars-cov-2-mutation-analysis-and-investigation)
- [** ](http://www.linkedin.com/shareArticle?url=https://blog.biosearchtech.com/technical-bulletin-omicron-impact-on-sars-cov-2-mutation-analysis-and-investigation&title=Technical%20bulletin:%20Omicron%20impact%20on%20SARS-CoV-2%20mutation%20analysis%20and%20investigation)
- [** ](http://twitter.com/intent/tweet?text=Technical%20bulletin:%20Omicron%20impact%20on%20SARS-CoV-2%20mutation%20analysis%20and%20investigation&url=https://blog.biosearchtech.com/technical-bulletin-omicron-impact-on-sars-cov-2-mutation-analysis-and-investigation)
- [** ](mailto:?subject=I%20wanted%20you%20to%20see%20this%20post&body=Check%20out%20this%20post%20.)

#### Like what you see? Share with a friend or comment below.

[** ](https://www.facebook.com/sharer/sharer.php?u=https://blog.biosearchtech.com/technical-bulletin-omicron-impact-on-sars-cov-2-mutation-analysis-and-investigation)

[** ](https://www.linkedin.com/shareArticle?mini=true&url=https://blog.biosearchtech.com/technical-bulletin-omicron-impact-on-sars-cov-2-mutation-analysis-and-investigation)

[** ](https://twitter.com/intent/tweet?url=https://blog.biosearchtech.com/technical-bulletin-omicron-impact-on-sars-cov-2-mutation-analysis-and-investigation&text=Omicron%20impact%20on%20SARS-CoV-2%20mutation%20analysis%20and%20investigation)

[** ](mailto:?subject=I%20wanted%20you%20to%20see%20this%20post&body=Check%20out%20this%20post%20.)

## Subscribe to our blog

## BiosearchTech Blog alerts

 Don’t forget to subscribe to the latest scientific content curated * by* scientists * for *scientists. You’ll receive an email twice a month or less.

### Subscribe to our blog

### About LGC, Biosearch Technologies

LGC, Biosearch Technologies is the complete Genomics portfolio from LGC. Providing genomic analysis tools, instrumentation and services to the genomic scientific discovery sector worldwide, with focus on across ag bio, pharma and molecular diagnostics. Visit our home page to [view our products and services](http://www.biosearchtech.com).

### Posts by category

- [Agrigenomics (37)](https://blog.biosearchtech.com/topic/agrigenomics)
- [CPG (2)](https://blog.biosearchtech.com/topic/cpg)
- [Disease detection (14)](https://blog.biosearchtech.com/topic/disease-detection)
- [Enzymes (3)](https://blog.biosearchtech.com/topic/enzymes)
- [General science (90)](https://blog.biosearchtech.com/topic/general-science)
- [Genomics (48)](https://blog.biosearchtech.com/topic/genomics)
- [KASP (4)](https://blog.biosearchtech.com/topic/kasp)
- [Molecular diagnostics (53)](https://blog.biosearchtech.com/topic/molecular-diagnostics)
- [mRNA therapeutics (2)](https://blog.biosearchtech.com/topic/mrna-therapeutics)
- [New and Featured (2)](https://blog.biosearchtech.com/topic/new-and-featured)
- [Next generation sequencing (NGS) (16)](https://blog.biosearchtech.com/topic/next-generation-sequencing-ngs)
- [NGS-based genotyping (19)](https://blog.biosearchtech.com/topic/ngs-based-genotyping)
- [Nucleic acid extraction (11)](https://blog.biosearchtech.com/topic/nucleic-acid-extraction)
- [Nucleic acid therapeutics (15)](https://blog.biosearchtech.com/topic/nucleic-acid-therapeutics)
- [Oligo synthesis and modifications (41)](https://blog.biosearchtech.com/topic/oligo-synthesis-and-modifications)
- [oligos probes and primers (4)](https://blog.biosearchtech.com/topic/oligos-probes-and-primers)
- [PCR-based genotyping (21)](https://blog.biosearchtech.com/topic/pcr-based-genotyping)
- [qPCR (61)](https://blog.biosearchtech.com/topic/qpcr)
- [RNA FISH (22)](https://blog.biosearchtech.com/topic/rna-fish)
- [SARS-CoV-2 (28)](https://blog.biosearchtech.com/topic/sars-cov-2)
- [Targeted GBS (4)](https://blog.biosearchtech.com/topic/targeted-gbs)

### Posts by popularity

### Follow @BiosearchTech on Twitter

[Tweets by @BiosearchTech](https://twitter.com/BiosearchTech)

### Become a Fan on Facebook!

### Visit our website

[biosearchtech.com](https://www.biosearchtech.com/)

### Contact us

- [** Contact us ](https://www.biosearchtech.com/about-us/locations)

### Connect with us

- [![twitter](https://blog.biosearchtech.com/hubfs/blog2020/twitter-1.png)Twitter ](https://twitter.com/LGCBiosearch)
- [** Facebook ](https://www.facebook.com/LGCBiosearch)
- [** Youtube ](https://www.youtube.com/user/lgcgroupvideo)
- [** LinkedIn ](https://www.linkedin.com/company/lgc-biosearch-technologies)

<http://www.lgcgroup.com/>

Copyright © 2023 LGC, Biosearch Technologies 

### About Us

- [About LGC Biosearch Technologies](https://www.biosearchtech.com/about-us/inside-lgc-biosearch)
- [Careers](https://www.biosearchtech.com/our-company/careers)
- [Shop](https://www.biosearchtech.com/about-us/distributors)

### Stay in Touch

- [Contact us](https://www.biosearchtech.com/about-us/contact-us)
- [Join our mailing list](https://www.biosearchtech.com/)

<http://www.lgcgroup.com/>

- <https://twitter.com/LGCBiosearch>
- [** ](https://www.facebook.com/LGCBiosearch)
- [** ](https://www.youtube.com/user/lgcgroupvideo)
- [** ](https://www.linkedin.com/company/lgc-biosearch-technologies)

Copyright © 2024 LGC Biosearch Technologies 

```json
{
  "@context" : "https://schema.org",
  "@type" : "BlogPosting",
  "author" : {
    "@type" : "Person",
    "name" : "Biosearch Technologies",
    "url" : "https://blog.biosearchtech.com/author/biosearch-technologies"
  },
  "dateModified" : "2024-02-08T08:34:58.219Z",
  "datePublished" : "2021-12-23T17:45:15.000Z",
  "headline" : "Omicron impact on SARS-CoV-2 mutation analysis and investigation",
  "image" : [ "https://blog.biosearchtech.com/hubfs/omicron.jpg" ],
  "mainEntityOfPage" : {
    "@id" : "https://blog.biosearchtech.com/technical-bulletin-omicron-impact-on-sars-cov-2-mutation-analysis-and-investigation",
    "@type" : "WebPage"
  },
  "publisher" : {
    "@type" : "Organization",
    "logo" : {
      "@type" : "ImageObject",
      "url" : "https://blog.biosearchtech.com/hubfs/LGC_D&G_Logos_RGB_LGC_D&G_Primary.png"
    },
    "name" : "Biosearch Technologies"
  }
}
```